enow.com Web Search

Search results

  1. Results from the WOW.Com Content Network
  2. Single-nucleotide polymorphism - Wikipedia

    en.wikipedia.org/wiki/Single-nucleotide_polymorphism

    In genetics and bioinformatics, a single-nucleotide polymorphism (SNP / s n ɪ p /; plural SNPs / s n ɪ p s /) is a germline substitution of a single nucleotide at a specific position in the genome. Although certain definitions require the substitution to be present in a sufficiently large fraction of the population (e.g. 1% or more), [ 1 ...

  3. Trellis coded modulation - Wikipedia

    en.wikipedia.org/wiki/Trellis_coded_modulation

    Trellis coded modulation (TCM) is a modulation scheme that transmits information with high efficiency over band-limited channels such as telephone lines. Gottfried Ungerboeck invented trellis modulation while working for IBM in the 1970s, and first described it in a conference paper in 1976. It went largely unnoticed, however, until he ...

  4. rs6313 - Wikipedia

    en.wikipedia.org/wiki/Rs6313

    In genetics, rs6313 also called T102C or C102T is a gene variation—a single nucleotide polymorphism (SNP)—in the human HTR2A gene that codes for the 5-HT 2A receptor.The SNP is a synonymous substitution located in exon 1 of the gene where it is involved in coding the 34th amino acid as serine.

  5. SNPedia - Wikipedia

    en.wikipedia.org/wiki/SNPedia

    SNPedia (pronounced "snipedia") is a wiki-based bioinformatics web site that serves as a database of single nucleotide polymorphisms (SNPs). Each article on a SNP provides a short description, links to scientific articles and personal genomics web sites, as well as microarray information about that SNP.

  6. SNP annotation - Wikipedia

    en.wikipedia.org/wiki/SNP_annotation

    Single nucleotide polymorphism annotation (SNP annotation) is the process of predicting the effect or function of an individual SNP using SNP annotation tools. In SNP annotation the biological information is extracted, collected and displayed in a clear form amenable to query.

  7. Haplogroup N-M231 - Wikipedia

    en.wikipedia.org/wiki/Haplogroup_N-M231

    Haplogroup N (M231) is a Y-chromosome DNA haplogroup defined by the presence of the single-nucleotide polymorphism (SNP) marker M231. [Phylogenetics 1]It is most commonly found in males originating from northern Eurasia.

  8. List of Y-DNA single-nucleotide polymorphisms - Wikipedia

    en.wikipedia.org/wiki/List_of_Y-DNA_single...

    Mutation number Nucleotide change Position () Total size () Position Forward 5′→3′ Reverse 5′→3′ M1 (YAP) 291bp insertion M2 A to G: 168 209 aggcactggtcagaatgaag

  9. SNP genotyping - Wikipedia

    en.wikipedia.org/wiki/SNP_genotyping

    SNP genotyping is the measurement of genetic variations of single nucleotide polymorphisms (SNPs) between members of a species. It is a form of genotyping, which is ...